rabbit antibody against zo-2 Search Results


99
Thermo Fisher rabbit zo 2
Rabbit Zo 2, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/rabbit zo 2/product/Thermo Fisher
Average 99 stars, based on 1 article reviews
rabbit zo 2 - by Bioz Stars, 2026-04
99/100 stars
  Buy from Supplier

86
Thermo Fisher rabbit polyclonals against zo2
Rabbit Polyclonals Against Zo2, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/rabbit polyclonals against zo2/product/Thermo Fisher
Average 86 stars, based on 1 article reviews
rabbit polyclonals against zo2 - by Bioz Stars, 2026-04
86/100 stars
  Buy from Supplier

94
Cell Signaling Technology Inc anti zo 2
Anti Zo 2, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/anti zo 2/product/Cell Signaling Technology Inc
Average 94 stars, based on 1 article reviews
anti zo 2 - by Bioz Stars, 2026-04
94/100 stars
  Buy from Supplier

86
Thermo Fisher polyclonal rabbit anti zo 2 antibody no 71 1400
Characteristics of primers, RT-PCR protocol and antibodies
Polyclonal Rabbit Anti Zo 2 Antibody No 71 1400, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/polyclonal rabbit anti zo 2 antibody no 71 1400/product/Thermo Fisher
Average 86 stars, based on 1 article reviews
polyclonal rabbit anti zo 2 antibody no 71 1400 - by Bioz Stars, 2026-04
86/100 stars
  Buy from Supplier

93
Santa Cruz Biotechnology rabbit anti zo 2 antibody
Characteristics of primers, RT-PCR protocol and antibodies
Rabbit Anti Zo 2 Antibody, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/rabbit anti zo 2 antibody/product/Santa Cruz Biotechnology
Average 93 stars, based on 1 article reviews
rabbit anti zo 2 antibody - by Bioz Stars, 2026-04
93/100 stars
  Buy from Supplier

90
Thermo Fisher rabbit anti–zo-2 pab
Characteristics of primers, RT-PCR protocol and antibodies
Rabbit Anti–Zo 2 Pab, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/rabbit anti–zo-2 pab/product/Thermo Fisher
Average 90 stars, based on 1 article reviews
rabbit anti–zo-2 pab - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Thermo Fisher anti-rabbit zona occluding-2
Characteristics of primers, RT-PCR protocol and antibodies
Anti Rabbit Zona Occluding 2, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/anti-rabbit zona occluding-2/product/Thermo Fisher
Average 90 stars, based on 1 article reviews
anti-rabbit zona occluding-2 - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Santa Cruz Biotechnology antibodies against zo2 (santa cruz biotechnology sc-11448, rabbit igg
Endothelial cells were infected for 2 h with S. aureus (MOI 10:1) or left uninfected. As indicated, cells were pretreated for 20 min with amitriptyline (Ami) (20 μM), Tiron (10 mM), or NAC (10 mM) before infection with S. aureus . Immunofluorescence stainings were performed with antibodies against ZO1, <t>ZO2,</t> occludin, or E-cadherin for determination of the degradation of these TJ proteins. The presented pictures are representative of the results of at least three independent experiments. Scale bar is 25 μm
Antibodies Against Zo2 (Santa Cruz Biotechnology Sc 11448, Rabbit Igg, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/antibodies against zo2 (santa cruz biotechnology sc-11448, rabbit igg/product/Santa Cruz Biotechnology
Average 90 stars, based on 1 article reviews
antibodies against zo2 (santa cruz biotechnology sc-11448, rabbit igg - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

96
Santa Cruz Biotechnology zo2
Fig. 4 Endothelial cells were infected for 2 h with S. aureus (MOI 10:1) or left uninfected. As indicated, cells were pretreated for 20 min with amitriptyline (Ami) (20 μM), Tiron (10 mM), or NAC (10 mM) before infection with S. aureus. Immunofluores- cence stainings were performed with antibodies against ZO1, <t>ZO2,</t> occludin, or E-cadherin for determination of the degradation of these TJ proteins. The present- ed pictures are representative of the results of at least three inde- pendent experiments. Scale bar is 25 μm
Zo2, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/zo2/product/Santa Cruz Biotechnology
Average 96 stars, based on 1 article reviews
zo2 - by Bioz Stars, 2026-04
96/100 stars
  Buy from Supplier

86
Thermo Fisher rabbit anti zo 2
Fig. 4 Endothelial cells were infected for 2 h with S. aureus (MOI 10:1) or left uninfected. As indicated, cells were pretreated for 20 min with amitriptyline (Ami) (20 μM), Tiron (10 mM), or NAC (10 mM) before infection with S. aureus. Immunofluores- cence stainings were performed with antibodies against ZO1, <t>ZO2,</t> occludin, or E-cadherin for determination of the degradation of these TJ proteins. The present- ed pictures are representative of the results of at least three inde- pendent experiments. Scale bar is 25 μm
Rabbit Anti Zo 2, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/rabbit anti zo 2/product/Thermo Fisher
Average 86 stars, based on 1 article reviews
rabbit anti zo 2 - by Bioz Stars, 2026-04
86/100 stars
  Buy from Supplier

96
Santa Cruz Biotechnology goat anti zo 2 antibodies
Fig. 4 Endothelial cells were infected for 2 h with S. aureus (MOI 10:1) or left uninfected. As indicated, cells were pretreated for 20 min with amitriptyline (Ami) (20 μM), Tiron (10 mM), or NAC (10 mM) before infection with S. aureus. Immunofluores- cence stainings were performed with antibodies against ZO1, <t>ZO2,</t> occludin, or E-cadherin for determination of the degradation of these TJ proteins. The present- ed pictures are representative of the results of at least three inde- pendent experiments. Scale bar is 25 μm
Goat Anti Zo 2 Antibodies, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/goat anti zo 2 antibodies/product/Santa Cruz Biotechnology
Average 96 stars, based on 1 article reviews
goat anti zo 2 antibodies - by Bioz Stars, 2026-04
96/100 stars
  Buy from Supplier

90
Thermo Fisher zo-2
Fig. 4 Endothelial cells were infected for 2 h with S. aureus (MOI 10:1) or left uninfected. As indicated, cells were pretreated for 20 min with amitriptyline (Ami) (20 μM), Tiron (10 mM), or NAC (10 mM) before infection with S. aureus. Immunofluores- cence stainings were performed with antibodies against ZO1, <t>ZO2,</t> occludin, or E-cadherin for determination of the degradation of these TJ proteins. The present- ed pictures are representative of the results of at least three inde- pendent experiments. Scale bar is 25 μm
Zo 2, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/zo-2/product/Thermo Fisher
Average 90 stars, based on 1 article reviews
zo-2 - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

Image Search Results


Characteristics of primers, RT-PCR protocol and antibodies

Journal: BMC Gastroenterology

Article Title: Role of tight junction proteins in gastroesophageal reflux disease

doi: 10.1186/1471-230X-12-128

Figure Lengend Snippet: Characteristics of primers, RT-PCR protocol and antibodies

Article Snippet: ZO-2 , fw: AGAGGACACGCCGAGCAGATTG rv: TCCCGACATCATTGCCACCAG 272 bp, 60°C , polyclonal rabbit anti-ZO-2 antibody No. 71–1400, (Invitrogen, Carlsbad, CA, USA, EDTA retrieval, Final dilution: 1:150.

Techniques: Sequencing

Endothelial cells were infected for 2 h with S. aureus (MOI 10:1) or left uninfected. As indicated, cells were pretreated for 20 min with amitriptyline (Ami) (20 μM), Tiron (10 mM), or NAC (10 mM) before infection with S. aureus . Immunofluorescence stainings were performed with antibodies against ZO1, ZO2, occludin, or E-cadherin for determination of the degradation of these TJ proteins. The presented pictures are representative of the results of at least three independent experiments. Scale bar is 25 μm

Journal: Journal of Molecular Medicine (Berlin, Germany)

Article Title: Acid sphingomyelinase inhibition protects mice from lung edema and lethal Staphylococcus aureus sepsis

doi: 10.1007/s00109-014-1246-y

Figure Lengend Snippet: Endothelial cells were infected for 2 h with S. aureus (MOI 10:1) or left uninfected. As indicated, cells were pretreated for 20 min with amitriptyline (Ami) (20 μM), Tiron (10 mM), or NAC (10 mM) before infection with S. aureus . Immunofluorescence stainings were performed with antibodies against ZO1, ZO2, occludin, or E-cadherin for determination of the degradation of these TJ proteins. The presented pictures are representative of the results of at least three independent experiments. Scale bar is 25 μm

Article Snippet: Samples were washed and incubated overnight at 4 °C with antibodies against ZO1 (Invitrogen 40-2300, rabbit IgG), ZO2 (Santa Cruz Biotechnology Inc. sc-11448, rabbit IgG), occludin (71-1500, rabbit IgG, Invitrogen), or E-cadherin (Santa Cruz Biotechnology Inc. sc-7870, rabbit IgG).

Techniques: Infection, Immunofluorescence

Fig. 4 Endothelial cells were infected for 2 h with S. aureus (MOI 10:1) or left uninfected. As indicated, cells were pretreated for 20 min with amitriptyline (Ami) (20 μM), Tiron (10 mM), or NAC (10 mM) before infection with S. aureus. Immunofluores- cence stainings were performed with antibodies against ZO1, ZO2, occludin, or E-cadherin for determination of the degradation of these TJ proteins. The present- ed pictures are representative of the results of at least three inde- pendent experiments. Scale bar is 25 μm

Journal: Journal of molecular medicine (Berlin, Germany)

Article Title: Acid sphingomyelinase inhibition protects mice from lung edema and lethal Staphylococcus aureus sepsis.

doi: 10.1007/s00109-014-1246-y

Figure Lengend Snippet: Fig. 4 Endothelial cells were infected for 2 h with S. aureus (MOI 10:1) or left uninfected. As indicated, cells were pretreated for 20 min with amitriptyline (Ami) (20 μM), Tiron (10 mM), or NAC (10 mM) before infection with S. aureus. Immunofluores- cence stainings were performed with antibodies against ZO1, ZO2, occludin, or E-cadherin for determination of the degradation of these TJ proteins. The present- ed pictures are representative of the results of at least three inde- pendent experiments. Scale bar is 25 μm

Article Snippet: Samples were washed and incubated overnight at 4 °C with antibodies against ZO1 (Invitrogen 40-2300, rabbit IgG), ZO2 (Santa Cruz Biotechnology Inc. sc-11448, rabbit IgG), occludin (71-1500, rabbit IgG, Invitrogen), or E-cadherin (Santa Cruz Biotechnology Inc. sc-7870, rabbit IgG).

Techniques: Infection