|
Thermo Fisher
rabbit zo 2 Rabbit Zo 2, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/rabbit zo 2/product/Thermo Fisher Average 99 stars, based on 1 article reviews
rabbit zo 2 - by Bioz Stars,
2026-04
99/100 stars
|
Buy from Supplier |
|
Thermo Fisher
rabbit polyclonals against zo2 Rabbit Polyclonals Against Zo2, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/rabbit polyclonals against zo2/product/Thermo Fisher Average 86 stars, based on 1 article reviews
rabbit polyclonals against zo2 - by Bioz Stars,
2026-04
86/100 stars
|
Buy from Supplier |
|
Cell Signaling Technology Inc
anti zo 2 Anti Zo 2, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/anti zo 2/product/Cell Signaling Technology Inc Average 94 stars, based on 1 article reviews
anti zo 2 - by Bioz Stars,
2026-04
94/100 stars
|
Buy from Supplier |
|
Thermo Fisher
polyclonal rabbit anti zo 2 antibody no 71 1400 ![]() Polyclonal Rabbit Anti Zo 2 Antibody No 71 1400, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/polyclonal rabbit anti zo 2 antibody no 71 1400/product/Thermo Fisher Average 86 stars, based on 1 article reviews
polyclonal rabbit anti zo 2 antibody no 71 1400 - by Bioz Stars,
2026-04
86/100 stars
|
Buy from Supplier |
|
Santa Cruz Biotechnology
rabbit anti zo 2 antibody ![]() Rabbit Anti Zo 2 Antibody, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/rabbit anti zo 2 antibody/product/Santa Cruz Biotechnology Average 93 stars, based on 1 article reviews
rabbit anti zo 2 antibody - by Bioz Stars,
2026-04
93/100 stars
|
Buy from Supplier |
|
Thermo Fisher
rabbit anti–zo-2 pab ![]() Rabbit Anti–Zo 2 Pab, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/rabbit anti–zo-2 pab/product/Thermo Fisher Average 90 stars, based on 1 article reviews
rabbit anti–zo-2 pab - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
|
Thermo Fisher
anti-rabbit zona occluding-2 ![]() Anti Rabbit Zona Occluding 2, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/anti-rabbit zona occluding-2/product/Thermo Fisher Average 90 stars, based on 1 article reviews
anti-rabbit zona occluding-2 - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
|
Santa Cruz Biotechnology
antibodies against zo2 (santa cruz biotechnology sc-11448, rabbit igg ![]() Antibodies Against Zo2 (Santa Cruz Biotechnology Sc 11448, Rabbit Igg, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/antibodies against zo2 (santa cruz biotechnology sc-11448, rabbit igg/product/Santa Cruz Biotechnology Average 90 stars, based on 1 article reviews
antibodies against zo2 (santa cruz biotechnology sc-11448, rabbit igg - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
|
Santa Cruz Biotechnology
zo2 ![]() Zo2, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/zo2/product/Santa Cruz Biotechnology Average 96 stars, based on 1 article reviews
zo2 - by Bioz Stars,
2026-04
96/100 stars
|
Buy from Supplier |
|
Thermo Fisher
rabbit anti zo 2 ![]() Rabbit Anti Zo 2, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/rabbit anti zo 2/product/Thermo Fisher Average 86 stars, based on 1 article reviews
rabbit anti zo 2 - by Bioz Stars,
2026-04
86/100 stars
|
Buy from Supplier |
|
Santa Cruz Biotechnology
goat anti zo 2 antibodies ![]() Goat Anti Zo 2 Antibodies, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/goat anti zo 2 antibodies/product/Santa Cruz Biotechnology Average 96 stars, based on 1 article reviews
goat anti zo 2 antibodies - by Bioz Stars,
2026-04
96/100 stars
|
Buy from Supplier |
|
Thermo Fisher
zo-2 ![]() Zo 2, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/zo-2/product/Thermo Fisher Average 90 stars, based on 1 article reviews
zo-2 - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
Image Search Results
Journal: BMC Gastroenterology
Article Title: Role of tight junction proteins in gastroesophageal reflux disease
doi: 10.1186/1471-230X-12-128
Figure Lengend Snippet: Characteristics of primers, RT-PCR protocol and antibodies
Article Snippet: ZO-2 , fw: AGAGGACACGCCGAGCAGATTG rv: TCCCGACATCATTGCCACCAG 272 bp, 60°C ,
Techniques: Sequencing
Journal: Journal of Molecular Medicine (Berlin, Germany)
Article Title: Acid sphingomyelinase inhibition protects mice from lung edema and lethal Staphylococcus aureus sepsis
doi: 10.1007/s00109-014-1246-y
Figure Lengend Snippet: Endothelial cells were infected for 2 h with S. aureus (MOI 10:1) or left uninfected. As indicated, cells were pretreated for 20 min with amitriptyline (Ami) (20 μM), Tiron (10 mM), or NAC (10 mM) before infection with S. aureus . Immunofluorescence stainings were performed with antibodies against ZO1, ZO2, occludin, or E-cadherin for determination of the degradation of these TJ proteins. The presented pictures are representative of the results of at least three independent experiments. Scale bar is 25 μm
Article Snippet: Samples were washed and incubated overnight at 4 °C with antibodies against ZO1 (Invitrogen 40-2300, rabbit IgG),
Techniques: Infection, Immunofluorescence
Journal: Journal of molecular medicine (Berlin, Germany)
Article Title: Acid sphingomyelinase inhibition protects mice from lung edema and lethal Staphylococcus aureus sepsis.
doi: 10.1007/s00109-014-1246-y
Figure Lengend Snippet: Fig. 4 Endothelial cells were infected for 2 h with S. aureus (MOI 10:1) or left uninfected. As indicated, cells were pretreated for 20 min with amitriptyline (Ami) (20 μM), Tiron (10 mM), or NAC (10 mM) before infection with S. aureus. Immunofluores- cence stainings were performed with antibodies against ZO1, ZO2, occludin, or E-cadherin for determination of the degradation of these TJ proteins. The present- ed pictures are representative of the results of at least three inde- pendent experiments. Scale bar is 25 μm
Article Snippet: Samples were washed and incubated overnight at 4 °C with antibodies against ZO1 (Invitrogen 40-2300, rabbit IgG),
Techniques: Infection